HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

The Greenbrier Companies NEWS


The Greenbrier Companies (GBX) Given a $50.00 Price Target by Wells Fargo Analysts  -  Week Herald
The Greenbrier Companies (NYSE:GBX) received a $50.00 target price from research analysts at Wells Fargo in a research note issued to investors on Monday, April 9th. The firm presently has a “hold” rating on the transportation company's stock. Wells ...
Free Report for GBX - Zacks.com Zacks
SEC FORM 4 - SEC.gov SEC.gov

The Greenbrier Companies (NYSE:GBX) Given New $54.00 Price Target at Stifel Nicolaus  -  StockNewsTimes
The Greenbrier Companies (NYSE:GBX) had its price objective reduced by Stifel Nicolaus from $55.00 to $54.00 in a research report sent to investors on Sunday, April 8th. They currently have a buy rating on the transportation company's stock. A number ...

The Greenbrier Companies (GBX) Price Target Cut to $54.00  -  Macon Daily
The Greenbrier Companies (NYSE:GBX) had its price objective lowered by Stifel Nicolaus from $55.00 to $54.00 in a research report report published on Sunday, April 8th. Stifel Nicolaus currently has a buy rating on the transportation company's stock ...

The Greenbrier Companies (NYSE:GBX) Lowered to “Buy” at ValuEngine  -  Macon Daily
The Greenbrier Companies (NYSE:GBX) was downgraded by investment analysts at ValuEngine from a “strong-buy” rating to a “buy” rating in a research note issued on Saturday, April 7th. Several other research firms also recently issued reports on GBX ...
Bargain or Bust? What's inside the Numbers For The Greenbrier Companies, Inc. (NYSE:GBX)  -  Danvers Record
After a recent scan, we can see that The Greenbrier Companies, Inc. (NYSE:GBX) has a Shareholder Yield of 0.010532 and a Shareholder Yield (Mebane Faber) of -0.13391. Companies may issue new shares and buy back their own shares. This may occur at the ...
The Greenbrier Companies, Inc. (NYSE:GBX): Investor Returns and Quant Valuation in the Spotlight  -  Aurora Gazette
The Greenbrier Companies, Inc. (NYSE:GBX) has a Price to Book ratio of 1.335512. This ratio has been calculated by dividing the current share price by the book value per share. Investors may use Price to Book to display how the market portrays the ...
Zacks: Analysts Anticipate Greenbrier Companies Inc (GBX) Will Announce Quarterly Sales of $531.50 Million  -  BangaloreWeekly
Wall Street brokerages predict that Greenbrier Companies Inc (NYSE:GBX) will post sales of $531.50 million for the current fiscal quarter, Zacks Investment Research reports. Three analysts have issued estimates for Greenbrier Companies' earnings, with ...

The Greenbrier Companies (GBX) Upgraded by Zacks Investment Research to Buy  -  Week Herald
The Greenbrier Companies (NYSE:GBX) was upgraded by Zacks Investment Research from a “hold” rating to a “buy” rating in a research note issued to investors on Thursday, March 29th. The brokerage currently has a $57.00 price target on the transportation ...
Dividend Diamond in Focus: The Greenbrier Companies, Inc. (NYSE:GBX)  -  Stanley Business News
Investors looking for a stable dividend stock with upside should take a look at The Greenbrier Companies, Inc. (NYSE:GBX). The stock currently provides a dividend yield of 2.03% for the Services company. Sell-side analysts covering the shares are ...
The Greenbrier Companies, Inc. (NYSE:GBX) Quant Signal Evaluation & Review  -  The Herald
In trying to determine the current valuation of The Greenbrier Companies, Inc. (NYSE:GBX) shares, we note that the Book to Market ratio of the shares stands at 0.748776. It's commonly accepted that a Book to Market ratio greater than one indicates that ...
 

The Greenbrier Companies Videos

The Greenbrier Companies
21:01:08
The Greenbrier Companies
The Greenbrier Companies in summary
20:34:08
The Greenbrier Companies in summary
Greenbrier Integrated Model
19:03:02
Greenbrier Integrated Model
Greenbrier 2016 Annual Company Review
16:06:18
Greenbrier 2016 Annual Company Review
Tom Jackson, VP Corp Marketing for The Greenbrier Companies, on Railway Interchange 2015
04:02:29
Tom Jackson, VP Corp Marketing for The Greenbrier Companies, on Railway Interchange 2015
Interview with The Greenbrier Companies at Middle East Rail 2017
10:23:16
Interview with The Greenbrier Companies at Middle East Rail 2017
Intro Greenbrier México
09:40:24
Intro Greenbrier México
Join Gunderson
22:22:57
Join Gunderson
The Greenbrier Companies #4
18:57:12
The Greenbrier Companies #4
Greenbrier Global Community Condensed
23:06:04
Greenbrier Global Community Condensed
 

The Greenbrier Companies Images

File:The Greenbrier Companies.svg - Wikimedia Commons
File:The Greenbrier Companies.svg - Wikimedia Commons
File:TheGreenbrierCompaniesLogo.png - Wikipedia
File:TheGreenbrierCompaniesLogo.png - Wikipedia
FEMA prisoner box cars with shackles and guillotines in ...
FEMA prisoner box cars with shackles and guillotines in ...
Portfolio
Portfolio
Greenbrier / Gunderson - Video Corporativo on Vimeo
Greenbrier / Gunderson - Video Corporativo on Vimeo
Kirby Offshore Returns to Gunderson for 2nd Tank Barge ...
Kirby Offshore Returns to Gunderson for 2nd Tank Barge ...
Greenbrier-Astra Rail transaction receives all approvals ...
Greenbrier-Astra Rail transaction receives all approvals ...
1200 Corporate Dr, Hoover | 42Floors
1200 Corporate Dr, Hoover | 42Floors
Mad Men Office Floor Plan of Sterling Cooper Draper Pryce
Mad Men Office Floor Plan of Sterling Cooper Draper Pryce
GCM Grosvenor
GCM Grosvenor
 

The Greenbrier Companies WebSites

The Greenbrier Companies is an American publicly-traded transportation manufacturing corporation based in Lake Oswego, Oregon, United States.Greenbrier specializes in transportation services, notably barge and railroad car manufacturing, railroad car refurbishment, and railroad car leasing/management services.
The Greenbrier Companies builds, leases, repairs, supplies, and manages railcars in North America, South America, Europe, and the Middle East.
Visit The Greenbrier and find out what it means to experience Life as Few Know It.
With one of the largest fleets in North America, from tank cars to covered hoppers, our 20+ years of railcar leasing experience is sure to meet your needs.
Greenbrier Companies, Inc. (GBX) seems to be a good value pick, as it has decent revenue metrics to back up its earnings, and is seeing solid earnings estimate revisions as well.
Stock quote for Greenbrier Companies, Inc. (The) Common Stock Common Stock (GBX) with real-time last sale and extended hours stock prices, company news, charts, and research at Nasdaq.
Greenbrier is a communications consulting firm that provides advice and executional support to clients facing complex image, marketing, media, legal and political challenges.
Located amid the breathtaking mountains of West Virginia, The Greenbrier is a National Historic Landmark and world-class resort that has been welcoming guests from around the world since 1778. The natural mineral springs that drew our first guests over 235 years ago continue to lure visitors to our ...
The 32nd Great Greenbrier River Race is on April 28, 2018. The 32nd annual Great Greenbrier River Race is held the last Saturday in April each year in Marlinton, WV.
According to our research of Arkansas and other state lists there were 19 registered sex offenders living in Greenbrier, Arkansas as of April 16, 2018. The ratio of number of residents in Greenbrier to the number of sex offenders is 274 to 1. Median real estate property taxes paid for housing units ...
 

The Greenbrier Companies Wiki

The Greenbrier Companies is an American publicly-traded transportation manufacturing corporation based in Lake Oswego, Oregon, United States. Greenbrier specializes in transportation services, notably barge and railroad car manufacturing, railroad car refurbishment, and railroad car leasing/management services. As of 2015, Greenbrier employs in excess of 10,689 people combined at its operations in Europe, Mexico, Canada, and the United States. Formed in 1981 and publicly traded since 1994, the company generates revenues of USD $2.61 billion.The company has manufacturing facilities in Portland, Oregon, Świdnica, Poland, and three railcar plants in Mexico: Monclova, Sahagun City, and Tlaxcala.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Micronesia Radio New Zealand The leaders of the nine states, territories and countries of Micronesia are gathering this week to thrash out issues including climate change, migration and their close but complicated relationship with the United States; The non government agency

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

LabCorp Jersey Shore Online NEW JERSEY – Ocean Health Initiatives, (OHI), the New Jersey Primary Care Association, (NJPCA), the New Jersey Department of Health, and LabCorp hosted a press conference to highlight Sexually Transmitted Infection (STI) Awareness Montht the press