HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites
 

House of Dereon NEWS


Boutique Boss: This Brooklyn Entrepreneur Opened A Boutique Spotlighting Designers From The Diaspora  -  Essence.com
ESSENCE's “Boutique Boss” highlights dynamic Black women entrepreneurs who are independent shop owners helping to create more opportunities to #BuyBlack and #ShopSmall. Meet Farai Simoyi, fashion designer and founder of T.N.T Concept Store, a boutique ...

Beyonce's father admits he dated her mother…  -  The Mercury News
NEW YORK – JUNE 23: (EXCLUSIVE) (L-R) Singer Beyonce Knowles (C) poses with her father and manager Matthew Knowles and her mother Tina Knowles at the “Beyonce: Beyond the Red Carpet auction presented by Beyonce and her mother Tina Knowles along with ...

Celebrity stylist uses tenacity and styling Beyoncé to launch fashion dynasty  -  Rolling Out
It takes more than bringing a pair of shoes and a couple of pieces to a photo shoot to earn the title celebrity stylist. From organizing fashion shows for Nautica, to working for House of Dereon, to being Beyoncé's personal stylist, Raquel Smith has ...

Beyonce's Dad Sells Houston Property Where Destiny's Child Recorded Some of Their Biggest Hits  -  Architectural Digest
Matthew Knowles relinquished a major piece of music history recently when he sold the Rice Mansion, the property where his Houston-based Music World Entertainment—and Destiny's Child—first put their names on the map. The iconic house, which was ...

Mathew Knowles Sells 'Music World Entertainment' Property Where Destiny's Child Was Launched  -  Eurweb.com
The property, where Destiny's Child recorded their early hits, was purchased by BMW dealer Group 1 Automotive in September. A Page Six source claims the Music World Entertainment space had fallen into disrepair and “from a security standpoint, it ...

Luxury eyewear line KIDRAQ looking for the next child supermodel  -  Rolling Out
After starting as an intern at House of Dereon, Raquel Smith worked her way up to assistant Beyonce's principal stylist Ty Hunter and then as her personal stylist. Smith has styled Beyoncé's red carpet appearances, video shoots, special performances ...

The building where Beyonce and Solange once recorded has seen its final days  -  Rare.us
So much for preserving historical Houston monuments. RELATED: A wax figure of Beyoncé is causing controversy because it looks nothing like her — and Twitter is having an absolute field day. The Midtown building where Beyonce and her sister Solange ...

Site where Beyoncé, Solange Knowles' recorded demolished in Houston  -  Chron.com
The new owners of the Midtown property where Beyoncé and her sister Solange once recorded have started demolition on the site. Photos taken this week show the demo of the House of Dereon Media Center, which was used as an event space. The property also ...

Thanks Tina! Has Beyonce's mum revealed the gender of her daughter's twins?  -  Irish Examiner
Beyonce Knowles and her mother Tina take the applause following their House of Dereon Catwalk Show in 2011 (Gareth Fuller/PA). Tina Lawson posted a short message and picture of her superstar daughter to her 1.2 million Instagram followers. Beyonce, who ...

Fans duped by Super Bowl Prince tribute concerts  -  Chron.com
It was billed as a celebration of the anniversary of Prince's iconic 2007 Super Bowl Half Time show. But the multi-night Super Bash -- two concerts scheduled to take place at the Music World/House of Dereon complex at 2204 Crawford during Super Bowl ...
 

House of Dereon Videos

House of Deréon Spring 2009 Campaign
20:26:47
House of Deréon Spring 2009 Campaign
Beyoncé Presents: House of Deréon at Selfridges
15:45:10
Beyoncé Presents: House of Deréon at Selfridges
Fashion: Beyonce - House of Dereon (Excerpt)
13:46:21
Fashion: Beyonce - House of Dereon (Excerpt)
Beyonce Photoshoot For House Of Dereon Spring/Summer 2010
16:10:12
Beyonce Photoshoot For House Of Dereon Spring/Summer 2010
Beyonce - House of Dereon
10:41:19
Beyonce - House of Dereon
House of Deréon and Deréon Fall 2009 Campaign
19:50:37
House of Deréon and Deréon Fall 2009 Campaign
House of Dereon Bedding Line
00:18:58
House of Dereon Bedding Line
New Beyoncé Dereon C&A Commercial
01:10:54
New Beyoncé Dereon C&A Commercial
BEYONCE on extra House of Dereon Preview
04:39:26
BEYONCE on extra House of Dereon Preview
House Of Deréon Spring/Summer 2010 Ad Campaign
21:15:28
House Of Deréon Spring/Summer 2010 Ad Campaign
 

House of Dereon Images

Ava Addams - Ava Addams -hot and sexy,Latest News, Photos ...
Ava Addams - Ava Addams -hot and sexy,Latest News, Photos ...
Family affair: Beyonce teams up with her mother to launch ...
Family affair: Beyonce teams up with her mother to launch ...
Beyonce & Tina Knowles Celebrate House of Dereon Collection
Beyonce & Tina Knowles Celebrate House of Dereon Collection
Pin Thread House Of Dereon Coats Hoody on Pinterest
Pin Thread House Of Dereon Coats Hoody on Pinterest
Full Sized Photo of beyonce dereon juniors 06 | Photo ...
Full Sized Photo of beyonce dereon juniors 06 | Photo ...
Beyoncé y su línea de Otoo-Invierno
Beyoncé y su línea de Otoo-Invierno
beyonce pregnant photo 2011 | Urban Islandz
beyonce pregnant photo 2011 | Urban Islandz
Selfridges Stock Photos and Pictures | Getty Images
Selfridges Stock Photos and Pictures | Getty Images
Beyonce Knowles 5
Beyonce Knowles 5
Solange Knowles Bio, Net Worth, Height, Facts | Dead or Alive?
Solange Knowles Bio, Net Worth, Height, Facts | Dead or Alive?
 

House of Dereon WebSites

Dereon Clothes ... Search. Home
Designer dresses for School Proms and Balls available from UK stock either in store or online at Cargo Clothing. Always the best UK price.
Check out the latest celebrity styles, most coveted beauty secrets, gorgeous new hairstyles, and everything red carpet from Stylish by Us Weekly.
Maxim's BANQUET Room. For a memorable reception highlighted by fantastic food and a rich, elegant atmosphere, there's no better place to go in Houston than Maxim's Banquet Room.
newyorkersapparel.com is one of the largest supplier of wholesale dresses and women's apparel, Wholesale Women’s Apparel Casual and Contemporary Dresses, prom, homecoming, cocktail, mother of the brides, stores and local boutiques.
Tina Lawson, mieux connue sous le nom de Tina Knowles, née Celestine Beyoncé ou Celestine Ann Beyincé le 4 janvier 1954 à Galveston au Texas, est une créatrice de mode [1] américaine connue pour sa société et maison de couture House of Deréon.
Designer Desirables is a luxury online retailer with a passion for glamorous womens designer clothing. For show stopping womens designer clothes visit Designer Desirables today.
BEYONCE KNOWLES Born: September 4, 1981 Height: 5' 7" Beyoncé Giselle Knowles, often referred to mononymously as Beyoncé, first began her musical career when she was 7 years old and met LaTavia Roberson while auditioning for a children's group.
Beyoncé Giselle Knowles-Carter (/ b iː ˈ j ɒ n s eɪ /; born September 4, 1981) is an American singer, songwriter and actress. Born and raised in Houston, Texas, Beyoncé performed in various singing and dancing competitions as a child.
Google is compensated by these merchants. Payment is one of several factors used to rank these results. Tax and shipping costs are estimates.
McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Micronesia Radio New Zealand The leaders of the nine states, territories and countries of Micronesia are gathering this week to thrash out issues including climate change, migration and their close but complicated relationship with the United States; The non government agency

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

LabCorp Jersey Shore Online NEW JERSEY – Ocean Health Initiatives, (OHI), the New Jersey Primary Care Association, (NJPCA), the New Jersey Department of Health, and LabCorp hosted a press conference to highlight Sexually Transmitted Infection (STI) Awareness Montht the press