HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

HNI Corporation NEWS

Insider Selling: HNI Co. (HNI) SVP Sells 4000 Shares of Stock  -  registrarjournal.com
HNI Co. (NYSE:HNI) SVP Kurt A. Tjaden sold 4,000 shares of the stock in a transaction on Monday, April 23rd. The stock was sold at an average price of $36.13, for a total value of $144,520.00. Following the completion of the transaction, the senior ...

HNI Corporation (HNI): Keep an Eye On Featured Stock:  -  StockQuote (press release)
HNI Corporation (HNI):. Picking a stock is very difficult job. There are many factors to consider before choosing a right stock to invest in it. If picking stocks was easy, everyone would be rich right? This piece of financial article provides a short ...
HNI Corporation (NYSE:HNI), Comfort Systems USA, Inc. (NYSE:FIX ...  -  Alba Journal
Investors may be interested in viewing the Gross Margin score on shares of HNI Corporation (NYSE:HNI). The name currently has a score of 1.00000. This score is derived from the Gross Margin (Marx) stability and growth over the previous eight years. The ...
Brokerages Set HNI Co. (HNI) PT at $42.00  -  Macon Daily
Shares of HNI Co. (NYSE:HNI) have been assigned a consensus rating of “Hold” from the nine ratings firms that are presently covering the firm, MarketBeat.com reports. Three analysts have rated the stock with a sell recommendation, three have assigned a ...
HNI (NYSE:HNI) Lowered to “Sell” at ValuEngine  -  Macon Daily
HNI Corporation manufactures and sells office furniture and hearth products in the United States, Canada, China, Hong Kong, India, Mexico, Dubai, and Taiwan. The company's Office Furniture segment offers a range of metal and wood commercial and home ...
$0.03 EPS Anticipated for HNI Corp (HNI) This Quarter  -  BangaloreWeekly
HNI Corporation is a provider of office furniture and hearth products. The Company's office furniture products include panel-based and freestanding furniture systems, seating, storage and tables. The Company's segments include office furniture and ...

Global Educational Furniture Market Trend Analysis by 2023: VS, Minyi Furniture, Haworth, noll and HNI Corporation  -  Perfect Analyst
The global Educational Furniture market research report studies the current market circumstances on a large scale to offer the Educational Furniture market consequences, market value, manufacturer share and growth valuation. The important information ...
Tjaden Sells 4000 Shares of HNI Co. (HNI) Stock  -  Newburgh Gazette
HNI stock traded up $0.49 during midday trading on Monday, reaching $36.36. 79,926 are owned by Rhumbline Advisers. Corporate insiders own 5.00% of the company's stock. 305 are owned by Dreman Value Mgmt L L C. State Farm Mutual Automobile Insurance ...
Is HNI Corporation (NYSE:HNI) Invest-able with a Beta of 1.35?  -  The Caller
Putting shares of HNI Corporation (NYSE:HNI) at the forefront, let's drill down into some key metrics. HNI Corporation (NYSE:HNI)'s shares may have a significant upside to the consensus target of 48, but how has it been performing relative to the ...
HNI Co. (HNI) Forecasted to Post Q3 2018 Earnings of $1.03 Per Share  -  Week Herald
HNI Co. (NYSE:HNI) – Analysts at Seaport Global Securities boosted their Q3 2018 earnings per share (EPS) estimates for shares of HNI in a research report issued on Monday, April 23rd. Seaport Global Securities analyst M. Mccall now forecasts that the ...
 

HNI Corporation Videos

HNI Corporation
15:54:16
HNI Corporation
HNI Corporation
15:14:04
HNI Corporation
\
22:27:45
\"We Believe\": HNI Core Beliefs and Values
HNI Engineering Careers
19:04:46
HNI Engineering Careers
We Believe: HNI Culture & Values
13:53:56
We Believe: HNI Culture & Values
HNI Ops and Supply Chain Careers
17:49:31
HNI Ops and Supply Chain Careers
Illinois Tool Works (ITW) and HNI Corporation (HNI): Today's Bull & Bear
13:44:15
Illinois Tool Works (ITW) and HNI Corporation (HNI): Today's Bull & Bear
Take a 360° Tour of Our Manufacturing Facilities | HNI
13:04:09
Take a 360° Tour of Our Manufacturing Facilities | HNI
Take a 360° Tour of Our Corporate Offices | HNI
13:04:11
Take a 360° Tour of Our Corporate Offices | HNI
HNI Early Career Opportunities
14:34:45
HNI Early Career Opportunities
 

HNI Corporation Images

HNI Corporation 2017 Q1 - Results - Earnings Call Slides ...
HNI Corporation 2017 Q1 - Results - Earnings Call Slides ...
HNI Corporation (HNI) Presents At The Raymond James 38th ...
HNI Corporation (HNI) Presents At The Raymond James 38th ...
HNI Corp (HNI) Declares Dividend Increase – $0.29 Per ...
HNI Corp (HNI) Declares Dividend Increase – $0.29 Per ...
Me G (@Me_Gofficial) Twitter Influencer Analysis | Klear
Me G (@Me_Gofficial) Twitter Influencer Analysis | Klear
Groove your business with some exquisite salon furniture ...
Groove your business with some exquisite salon furniture ...
Elevate Iowa - Kreg Tool
Elevate Iowa - Kreg Tool
KSRTC IMAGE DATABASE: Inside of Super Deluxe Air Bus
KSRTC IMAGE DATABASE: Inside of Super Deluxe Air Bus
Multi-Color on the Forbes America's Best Small Companies List
Multi-Color on the Forbes America's Best Small Companies List
venkatesh Narayanan resume - supply chain
venkatesh Narayanan resume - supply chain
Partners
Partners
 

HNI Corporation WebSites

Leading Global Provider of Office Furniture and Hearth Products. HNI Corporation is a family of leading brands providing products and services for the office and home.
HNI Corp. stock price, stock quotes and financial overviews from MarketWatch.
HNI Corporation is a family of leading brands providing products and services for the office and home. With deeply held values, our employees, who we call members, are united by a dedication to integrity, quality, innovation, service, continuous improvement and value creation for our customers.
HNI Corporation (formerly HON Industries) is the second-largest office furniture manufacturer in the world in regard to revenues resulting from office segment sales ...
HNI CorporationFrom a struggling company called Home-O-Nize to industry leader HNI Corporation, visitors to the HNI exhibit witness the transformation of a company launched in Muscatine.
HNI Corporation Reports Strong Sales Growth For First Quarter Fiscal Year 2018
Press HNI Corporation Named One Of The World's Best Companies for Leadership Development By Chief Executive Magazine: year-2014: year-2014: Feb 04 2014:
View HNI Corporation HNI investment & stock information. Get the latest HNI Corporation HNI detailed stock quotes, stock data, Real-Time ECN, charts, stats and more.
View the basic HNI stock chart on Yahoo Finance. Change the date range, chart type and compare HNI Corporation against other companies.
MUSCATINE, Iowa, April 20, 2018 /PRNewswire/ -- HNI Corporation (NYSE: HNI) announced today, the retirement of Stan A. Askren and the promotion of Jeffrey D. Lorenger as President, HNI Corporation and the election of Mr. Lorenger to the Board of Directors of HNI Corporation. Mr. Askren informed the ...
 

HNI Corporation Wiki

HNI Corporation (formerly HON Industries) is the second-largest office furniture manufacturer in the world in regard to revenues resulting from office segment sales, behind Steelcase. Its headquarters is in Muscatine, Iowa U.S. HNI is the leading gas and woodburning fireplace manufacturer and marketer in the United States. HNI's brands include The HON Company, Allsteel, Gunlocke, Paoli, Maxon, HBF, Sagus, Heatilator, Heat & Glo, Harman, Quadra-Fire, Lamex and OFM, Inc. The company was founded in 1944 by engineer C. Maxwell Stanley, advertising executive Clem Hanson, and industrial designer H. Wood Miller.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Micronesia Radio New Zealand The leaders of the nine states, territories and countries of Micronesia are gathering this week to thrash out issues including climate change, migration and their close but complicated relationship with the United States; The non government agency

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

LabCorp Jersey Shore Online NEW JERSEY – Ocean Health Initiatives, (OHI), the New Jersey Primary Care Association, (NJPCA), the New Jersey Department of Health, and LabCorp hosted a press conference to highlight Sexually Transmitted Infection (STI) Awareness Montht the press