HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

GlobalFoundries NEWS

Mobile Semiconductor's 22nm ULL memory compiler joins the GlobalFoundries FDXcelerator Partner Program  -  ElectroIQ (blog)
Mobile Semiconductor, a Seattle WA based company, today announced the inclusion of its new 22nm ULL (Ultra Low Leakage) memory compilers in the industry leading GLOBALFOUNDRIES FDXcelerator Program. This new embedded SRAM technology on 22nm FDX offers ...

Global Flip Chip Market Review 2018-2025 Nepes, Global Foundries, Samsung Group, Amkor  -  InsiderCarNews24
Detailed market study on the “Global Flip Chip Market” Research Report 2018-2025 By Globe Info Research. It analyses the important factors of the Flip Chip market based on present industry situations, Flip Chip market demands, business strategies ...

The AMD 2nd Gen Ryzen Deep Dive: The 2700X, 2700, 2600X, and 2600 Tested  -  AnandTech
With 2017 finished, and Ryzen being very successful for AMD, the inevitable question was due: what happens next? Early in 2018, the plans were laid bare: a second generation Ryzen processor was set to come in mid-year, followed by a second generation ...

Searching For EUV Defects  -  SemiEngineering
E-beam metrology combines the best of both worlds. A toolmaker takes an e-beam inspection system and adds image measurement algorithms from a CD-SEM, enabling the machine to take measurements in a full field of view. “You make the e-beam tool faster ...

Global Next Generation Transistor Market 2018 By Key Players – ST Microelectronics, GlobalFoundries, NXP ...  -  Highland Mirror
The research study Global Next Generation Transistor Industry offers strategic assessment of the Global Next Generation Transistor market. Global Next Generation Transistor market size is estimated to rise from USD xx million in 2018 to USD xx million ...

Global Flip Chip Market Size 2018 – STMicroelectronics, Texas Instruments, Global Foundries and Amkor  -  Investor Opinion
Global Flip Chip market research report centers around the latest trends and developments in Flip Chip market having six years of forecast period from 2018 to 2023 considering market status study from 2013 to 2018. What exclusive this report provides ...
Silicon Photonics Transceiver Market Size, competitive landscape is provided ,Revenue forecast 2022  -  The Columnist
Some of the key players mentioned in this research are Acacia, Luxtera, Intel, Cisco, Mellanox, Finisar, Globalfoundries, Hamamatsu, IBM, Juniper&Stmicroelectronics. Enquire for customization in Report @ https://www.htfmarketreport.com/enquiry-before ...

Global FinFET Technology Market 2018 Technology – Intel, TSMC, Samsung, GlobalFoundries, SMIC, Qualcomm ...  -  Software News
Global FinFET Technology Market 2018 Analysis, Forecsating, 2022, Research, Supply, Market Segmentation, Demand and Shares. FinFET Technology Market 2018 is a comprehensive, professional report provides a detailed overview of major drivers, restraints ...
Globalfoundries & Toppan extends German photomask JV  -  evertiq.com
Globalfoundries and Toppan Photomasks, Inc. (TPI) has announced a multi-year extension to their Advanced Mask Technology Center (AMTC) joint venture in Dresden, Germany. Opened in 2002, the AMTC provides GF's fabs in Dresden, Malta and Singapore with ...
GLOBALFOUNDRIES y Toppan Photomasks amplían su empresa conjunta de fotomáscaras avanzadas en Alemania  -  PR Newswire (Comunicado de prensa)
ROUND ROCK (Texas), SANTA CLARA (California) y DRESDE (Alemania), 10 de abril de 2018 /PRNewswire/ -- GLOBALFOUNDRIES Inc. (GF) y Toppan Photomasks, Inc. (TPI) han anunciado hoy una ampliación para varios años de su empresa conjunta Advanced Mask ...
 

GlobalFoundries Videos

globalfoundries
17:08:06
globalfoundries
GLOBALFOUNDRIES Sand to Silicon
20:06:19
GLOBALFOUNDRIES Sand to Silicon
GlobalFoundries ITDC Fab 8
15:23:39
GlobalFoundries ITDC Fab 8
An Important Step Forward for GLOBALFOUNDRIES
20:27:31
An Important Step Forward for GLOBALFOUNDRIES
Globalfoundries 2016
18:29:35
Globalfoundries 2016
GLOBALFOUNDRIES Fab 8: STEM Careers Business Showcase Video Series 2
12:50:09
GLOBALFOUNDRIES Fab 8: STEM Careers Business Showcase Video Series 2
GLOBALFOUNDRIES Fab 1 Dresden- Vom Sand zum Chip
07:41:14
GLOBALFOUNDRIES Fab 1 Dresden- Vom Sand zum Chip
Step Inside: GLOBALFOUNDRIES
09:45:07
Step Inside: GLOBALFOUNDRIES
How a CPU is made ? Global Foundries | Inctutorial | Semiconductor history |
23:52:11
How a CPU is made ? Global Foundries | Inctutorial | Semiconductor history |
GLOBALFOUNDRIES Webinar: Challenges and Solutions for 14nm Digital Design Reference Flows
22:48:12
GLOBALFOUNDRIES Webinar: Challenges and Solutions for 14nm Digital Design Reference Flows
 

GlobalFoundries Images

Qualcomm's Bill Davidson Goes to Globalfoundries
Qualcomm's Bill Davidson Goes to Globalfoundries
GLOBALFOUNDRIES - Building Fab 8 - HardOCP - YouTube
GLOBALFOUNDRIES - Building Fab 8 - HardOCP - YouTube
IBM, GlobalFoundries deal to close July 1; new look for tech
IBM, GlobalFoundries deal to close July 1; new look for tech
International Buyers Targeting the U.S. Real Estate Market
International Buyers Targeting the U.S. Real Estate Market
Product Development Technology Station (PDTS) - CUT, South ...
Product Development Technology Station (PDTS) - CUT, South ...
TSMC Roadmap Update: Will Be Ready To Take 7nm Orders By ...
TSMC Roadmap Update: Will Be Ready To Take 7nm Orders By ...
AMD Ryzen 7 2700X & Ryzen 5 2600X Review - TechSpot
AMD Ryzen 7 2700X & Ryzen 5 2600X Review - TechSpot
Record Fab Spending for 2017 and 2018 | SEMI.ORG
Record Fab Spending for 2017 and 2018 | SEMI.ORG
AMD Vega 10 and Vega 20 GPU Details Leak Out - 12 TFLOPs ...
AMD Vega 10 and Vega 20 GPU Details Leak Out - 12 TFLOPs ...
Leading Chipmakers Eye EUV Lithography to Save Moore’s Law ...
Leading Chipmakers Eye EUV Lithography to Save Moore’s Law ...
 

GlobalFoundries WebSites

GLOBALFOUNDRIES is a semiconductor foundry, manufacturing integrated circuits in high volume mostly for semiconductor technology companies across the globe.
GlobalFoundries is planning an aggressive rollout schedule for next-generation technologies like 7nm manufacturing and FD-SOI. ...
globalfoundries ( グローバルファウンドリーズ )はアメリカ合衆国の半導体製造企業。 ファウンドリとしてはtsmcに次いで世界第2位。
Globalfoundries est l'une des plus importantes fonderies de semiconducteurs indépendante au monde, deuxième après TSMC.Son siège social est situé à Sunnyvale en Californie.
The development of its own 7nm technology is a significant milestone for customers like AMD and IBM that need the highest performance. But GlobalFoundries has also evolved into a full-service foundry with a range of technology and products.
GlobalFoundries' new CEO is a familiar face Tom Caulfield led the transformation, growth of Fab 8
Thomas Caulfield, the fourth CEO of GlobalFoundries in less than a decade, joined the company in 2014, just months before GF agreed to take over IBM's Microelectronics unit, where he worked from 1989 to 2005. At GlobalFoundries, Dr. Caulfield served as the general manager of the company’s Fab 8 ...
GlobalFoundries is the #2 pure-play foundry and has some elite customers like Qualcomm, AMD, Broadcom and SkyWorks. I also believe Apple is a customer. I spent the day last week at GF's annual tech show, GTC 2017, and wanted to tell you about it.
Sanjay Kumar Jha (born 1963) was the former CEO of GlobalFoundries and former chairman and chief executive officer of Motorola Mobility.Prior to that he was the chief operating officer of Qualcomm
There are only a handful of companies in the world that design processors using leading-edge technology. Even fewer are equipped to manufacture these chips. Intel makes its own, Taiwan's TSMC and GlobalFoundries are pure-play foundries that make chips for other companies, and Samsung is a little of ...
 

GlobalFoundries Wiki

GlobalFoundries is an American semiconductor foundry headquartered in Santa Clara, California, United States. GlobalFoundries was created by the divestiture of the manufacturing arm of Advanced Micro Devices (AMD) on March 2, 2009, expanded through the acquisition of Chartered Semiconductor on January 23, 2010, and further expanded through the acquisition of IBM Microelectronics on July 1, 2015. The Emirate of Abu Dhabi is the owner of the company through its subsidiary Advanced Technology Investment Company (ATIC). On March 4, 2012, AMD announced they divested their final 14% stake in the company, which concluded AMD's multi-year plan to divest its manufacturing arm.The firm manufactures integrated circuits in high volume mostly for semiconductor companies such as AMD, Broadcom, Qualcomm, and STMicroelectronics. It has five 200 mm wafer fabrication plants in Singapore, one 300 mm fabrication plant in both Germany and Singapore, and three fabrication plants in the United States: one 200 mm fabrication plant in Vermont (where it is the largest private employer) and two 300 mm fabrication plants in New York.Thomas Caulfield is the Chief Executive Officer (CEO) of GlobalFoundries.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861