HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

Focus Brands NEWS


Boyden Fills Board Positions for Goodwill Industries  -  Hunt Scanlon Media (press release)
April 19, 2018 – Boyden has placed Joe Guith, Matthew Wadiak and Etienne Patout as members of the board of directors at Goodwill Industries International. “After an exhaustive search, Boyden is enthusiastic about the talent that Joe, Matthew and ...
New & Notable: World Pizza Games, Eating Banana Peels and Reinventing the Water Fountain  -  Modern Restaurant Management
Joe Guith joined FOCUS Brands, parent company to McAlister's Deli, in 2014 as Chief Operating Officer for Cinnabon®, and quickly assumed the role of brand president in 2015. In the three years Guith was president, he drove significant P&L results ...

Bring your brand's personality to every piece of content  -  PR Daily
Victoria Nielsen, senior social media manager for Focus brands, isn't breaking a sweat, though. She's developed content for Moe's Southwest Grill, Food Network, Refinery 29 and more—and she knows that capturing your brand's authentic voice is the key ...

Kristen Hartman named Cinnabon president  -  The Business Journals
Focus Brands has named Kristen Hartman president of its Cinnabon bakery chain, Restaurant Business reports. Hartman was formerly senior vice president of brand marketing strategy for all of Focus' restaurant brands, per Restaurant Business. She joined ...
Hartman Becomes President of Cinnabon  -  Foodservice Equipment & Supplies
FOCUS Brands promoted Kristen Hartman to president of its Cinnabon concept. She most recently served as the company's senior vice president of brand marketing strategy. In 2012 FOCUS Brands hired Hartman to serve as vice president of marketing, working ...

Cinnabon names Kristen Hartman brand president  -  Nation's Restaurant News
Cinnabon has named Kristen Hartman brand president, the bakery chain said Wednesday. It's a brand the executive knows well. Hartman joined Atlanta-based Focus Brands, which owns Cinnabon, in 2012 as vice president of marketing, where she oversaw brand ...
Kristen Hartman Promoted to Brand President of Cinnabon  -  QSR magazine
Cinnabon Inc., the brand synonymous with the world's most delicious cinnamon roll, announced that Kristen Hartman has been promoted to Brand President. In her new role, Hartman will be responsible for the brand's strategy and continued business growth ...

Cinnabon fills brand president role  -  Food Business News
ATLANTA — Kristen Hartman has been promoted to brand president at Cinnabon, Inc., a subsidiary of Focus Brands, Inc. Ms. Hartman will be responsible for the brand's strategy and continued business growth. Ms. Hartman joined Focus Brands in 2012 as ...

MRM Franchise Feed: Unique Restaurant Apprenticeship Launches and Pretzels on the Go  -  Modern Restaurant Management
At Wingstop, he managed 16 states in the Southeast, Northeast and Mid-Atlantic, and was responsible for the creation and rollout of a franchise sales marketing plan that helped generate significant openings. Sweetman also previously spent eight years ...
Joe Guith Promoted to Brand President of McAlister's Deli  -  Franchising.com
April 06, 2018 // Franchising.com // ATLANTA - McAlister's Deli®, a leading fast-casual restaurant chain home to handcrafted sandwiches, always-fresh salads, giant stuffed spuds, and McAlister's Famous Sweet Tea™, announced veteran leader Joe Guith ...
 

Focus Brands Videos

Focus Brands
16:16:42
Focus Brands
Focus Brands Group President on Cinnabon, Hillary Clinton
18:03:32
Focus Brands Group President on Cinnabon, Hillary Clinton
Kat Cole, Group President, FOCUS Brands
20:36:49
Kat Cole, Group President, FOCUS Brands
Focus Brands Convention 2016
18:56:25
Focus Brands Convention 2016
Paul Damico of Focus Brands - Predicting the Future of Fast Casual
17:31:53
Paul Damico of Focus Brands - Predicting the Future of Fast Casual
TEDx Talks Speaker Billionaire P.A.\
20:57:23
TEDx Talks Speaker Billionaire P.A.\" Talks On Focus Brand
In Focus Brands
16:07:30
In Focus Brands
Focus Brands Demo Reel
13:10:34
Focus Brands Demo Reel
Sport in Focus: Brands on the Ball - Trailer
08:46:32
Sport in Focus: Brands on the Ball - Trailer
Out of Focus #60 - battle of the brands 2017
21:17:52
Out of Focus #60 - battle of the brands 2017
 

Focus Brands Images

ford focus wagon iii 2014 models - Auto-Database.com
ford focus wagon iii 2014 models - Auto-Database.com
Pictures of ford focus hatchback iii 2014 - Auto-Database.com
Pictures of ford focus hatchback iii 2014 - Auto-Database.com
Pictures of ford focus 2002 - Auto-Database.com
Pictures of ford focus 2002 - Auto-Database.com
2018 Ford Torino Review, Release date and Price
2018 Ford Torino Review, Release date and Price
MAC Cosmetics runaway leader in cosmetics social ...
MAC Cosmetics runaway leader in cosmetics social ...
Yamaha PW-System – USA, 500W – Racecouk
Yamaha PW-System – USA, 500W – Racecouk
GC Eyewear | GalacticGalactic
GC Eyewear | GalacticGalactic
Victoria's Secret | BOOK For Buyers
Victoria's Secret | BOOK For Buyers
Pretty Fluffy
Pretty Fluffy
MSME | Focus Imaging Systems
MSME | Focus Imaging Systems
 

Focus Brands WebSites

Focus Brand's Website. This website and the franchise sales information on this site do not constitute an offer to sell a franchise.
Enter your registered email address with Guest-Note. Cancel
What makes a brand successful in the digital age? A joint study by SAP, Siegel+Gale, and Shift Thinking suggests that digital brands don’t just do things differently; they also think differently. Where traditional brands focus on positioning their brands in the minds of their customers, digital ...
Products. Storage & Transportation. Shelving; Security & Enclosure; Heavy-Duty & Dunnage Shelving; HDS-Plus; Wine Storage; Aluminum Bakery and Utility Racks
Simple Focus is a user experience agency specializing in web design, digital product design and interface design.
West Bend ®, an innovator in the world of kitchen electric solutions, has been in business since 1911.From the first drip coffee maker in 1922 to becoming the leading manufacturer of coffee urns by the 1970s, West Bend ® has been a leading supplier to the retail, food service and hospitality markets.
At WellBiz Brands, Inc. we are passionate about changing lives. Each brand complements the way our franchise owners and clients choose to live — healthy and balanced.
Marketing To Generation Z: Millennials Move Aside As Brands Shift Focus To Under-18 Customers
The bicycle is the perfect answer to social challenges related to health, ageing and congested cities. Pon’s growth ambitions target various consumer segments.
Order discount contact lenses online for less using our 1800Contacts coupons and Vision Direct coupon codes. Buy contact lenses online including soft color disposable contacts, toric, bifocal, Acuvue and Freshlook lens for cheap prices.
 

Focus Brands Wiki

Focus Brands is an affiliate of the Atlanta-based private equity firm, Roark Capital Group, that currently owns the Schlotzsky's, Carvel, Cinnabon, Moe's Southwest Grill, McAlister's Deli, and Auntie Anne's brands. It is based in Sandy Springs, Georgia and operates over 5,000 stores.It purchased Cinnabon from AFC Enterprises in 2004 and Schlotzsky's from Bobby Cox Companies in 2006.On August 11, 2007, Focus Brands announced that it purchased the Moe's Southwest Grill brand from Raving Brands.In October 2010, Focus Brands acquired the mostly mall-based franchiser Auntie Anne's, a maker of pretzels.In June of 2017, Kat Cole was named Chief Operating Officer.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861