HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites
 

FileMaker Inc NEWS


Global Database Management System (DBMS) Market 2018 – IBM, Oracle, PostgreSQL, NCR, Pervasive Software ...  -  Technology 24
The report emphasizes on the regional market, the key players within the market, and also the numerous market segments with associate degree in-depth analysis on totally different divisions and their applications. The report offers comprehensive ...

FileMaker, Inc. and 42 Silicon Valley Launch Initiative to Expand Education Access and Build Developer Talent  -  Digital Journal
FileMaker, an Apple subsidiary, and computer programming school 42 Silicon Valley announced today the launch of an innovative program to make education and careers in IT accessible to students from all walks of life. FileMaker has teamed up with 42 to ...

App development using low code and no code report in  -  App Developer Magazine
Using low code and no code to create custom mobile apps is being more widely adopted by organizations because of its flexibility in development finds new report from Apple subsidiary FileMaker, Inc. Creating custom mobile apps using low code and no ...
FileMaker's 2018 State of the Custom App Report Finds Productivity Nearly Doubling as Inefficiencies Decrease  -  PR Newswire (press release)
Ann Monroe, vice president of worldwide marketing and customer success, FileMaker, Inc., said: "Prior to adopting custom apps, businesses reported struggling with paper processes, scattered sources of information, complex spreadsheets and significant ...
FileMaker Named a Leader in G2 Crowd Report for No-Code Development Platforms  -  PR Newswire (press release)
SANTA CLARA, Calif., Jan. 24, 2018 /PRNewswire/ -- FileMaker, Inc. has been recognized as a Leader with a 91 percent satisfaction rating in G2 Crowd's Grid® for No-Code Platforms. FileMaker has the largest market presence and received the highest ...

The Office stars reunite for FileMaker, Inc. advertisement  -  Daily Mail
The Office stars reunite for FileMaker, Inc. #FarmTime The Mini Movie advertisement. Kate Flannery, Paul Lieberstein and Leslie David Baker became farmers for the hilarious commercial. School girl dance group 'Rise' discuss... Read More 0:39min Sir ...

Working with low-code platforms: 10 tips to drive value for your business  -  TechRepublic
Businesses unable to hire developers are increasingly using low-code or no-code tools, which allow tech and business professionals with no coding experience to build apps and potentially fill talent gaps in their organization. Forrester predicts that ...
Global Database Management System Market to grow at a CAGR of +8.5% by 2024: Focusing on Trending Key players ...  -  satPRnews (press release)
Leading key players operating in the Database Management System market include Microsoft, Software AG, IBM, Oracle, PostgreSQL, NCR, Pervasive Software, Tandem, FileMaker Inc. and others. The telecommunication segment is currently leading the global ...
FileMaker Cloud Joins the FileMaker 16 Platform with New Features  -  PR Newswire (press release)
SANTA CLARA, Calif., Oct. 26, 2017 /PRNewswire/ -- Today FileMaker, Inc. announced availability of the latest version of FileMaker Cloud, its cloud platform for managing and running custom apps. With this release, FileMaker Cloud joins the FileMaker 16 ...
FileMaker and 42 Silicon Valley Announce Partnership for Software Engineer Intern Program and Strategic App ...  -  PR Newswire (press release)
Brad Freitag, Vice President of Worldwide Sales at FileMaker, Inc. and executive sponsor of the partnership, commented on why the 42 partnership is significant for FileMaker, Inc.: "By partnering with 42 Silicon Valley, we are able to connect their ...
 

FileMaker Inc Videos

FileMaker, Inc.
20:15:16
FileMaker, Inc.
FileMaker Training Videos
20:49:56
FileMaker Training Videos
What is FileMaker? | FileMaker Pro 15 News  | FileMaker Pro 15 Videos | FileMaker 15 Training
20:02:32
What is FileMaker? | FileMaker Pro 15 News | FileMaker Pro 15 Videos | FileMaker 15 Training
Guy Stevens
17:58:22
Guy Stevens
Filemaker Pro Basics for beginners
21:01:01
Filemaker Pro Basics for beginners
Filemaker Pro Container Fields
18:05:12
Filemaker Pro Container Fields
How To Use FileMaker Pro 16 - Part 1
15:26:36
How To Use FileMaker Pro 16 - Part 1
Understanding FileMaker Relationships | FileMaker Pro 16 Videos | FileMaker 16 Training
21:56:48
Understanding FileMaker Relationships | FileMaker Pro 16 Videos | FileMaker 16 Training
FileMaker 16 - New Features & Functionality
13:47:40
FileMaker 16 - New Features & Functionality
Quickly Create a Custom App with FileMaker 15
15:18:26
Quickly Create a Custom App with FileMaker 15
 

FileMaker Inc Images

FMP 11 Line Chart | Screenshot of FileMaker Pro 11 sample ...
FMP 11 Line Chart | Screenshot of FileMaker Pro 11 sample ...
Create custom apps | FileMaker — An Apple Subsidiary
Create custom apps | FileMaker — An Apple Subsidiary
FileMaker Logo / Software / Logonoid.com
FileMaker Logo / Software / Logonoid.com
Filemaker Pro Calendar Template | Calendar Template 2016
Filemaker Pro Calendar Template | Calendar Template 2016
eXcelisys Certified FileMaker Programmers | FileMaker ...
eXcelisys Certified FileMaker Programmers | FileMaker ...
FYI - iOS Status Bar In FileMaker Go - The Scarpetta Group ...
FYI - iOS Status Bar In FileMaker Go - The Scarpetta Group ...
eXcelisys Cinema Camera Reboots With FileMaker Pro Camera ...
eXcelisys Cinema Camera Reboots With FileMaker Pro Camera ...
SUI Calendar, a FileMaker Pro calendar template. Available ...
SUI Calendar, a FileMaker Pro calendar template. Available ...
FileMaker Pro 13 Icon Replacement | HomeBase Software
FileMaker Pro 13 Icon Replacement | HomeBase Software
Gavin Turk | Knob
Gavin Turk | Knob
 

FileMaker Inc WebSites

Transform your business with the FileMaker Platform. Create custom apps to meet your unique business needs.
Learn more about how Apple subsidiary FileMaker, Inc. delivers simply powerful software for easily creating custom apps on iOS, desktop, and the web.
FileMaker Pro is a cross-platform relational database application from FileMaker Inc., a subsidiary of Apple Inc. It integrates a database engine with a graphical user interface and security features, allowing users to modify the database by dragging new elements into layouts, screens, or forms.
FileMaker Licensing for Teams A simple way for teams of 5 or more people to license FileMaker software. FileMaker Licensing for Teams includes FileMaker Server and User Connections for your team to access your custom apps through FileMaker Pro (for User Connections), FileMaker Go, or FileMaker WebDirect.
Pearson VUE delivers certification exams for FileMaker, Inc.
Books & Videos. Info to help you get the most out FileMaker.
FM Starting Point is a completely FREE FileMaker template designed for use with FileMaker® Pro 16, and is focused on small businesses, work groups, and non-profit organizations.
FileMaker starting kit with professional training videos produced by certified FileMaker developer, Richard Carlton.
FileMaker Pro and Lasso tips & tricks, downloads and courseware.
FileMaker Pro Entwickler: FileMaker, Inc. Aktuelle Version 16 (9. Mai 2017) Betriebssystem: iOS, macOS, Mac OS Classic, Windows (ab 7): Kategorie: Datenbanksystem: Lizenz: proprietär
McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Micronesia Radio New Zealand The leaders of the nine states, territories and countries of Micronesia are gathering this week to thrash out issues including climate change, migration and their close but complicated relationship with the United States; The non government agency

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

LabCorp Jersey Shore Online NEW JERSEY – Ocean Health Initiatives, (OHI), the New Jersey Primary Care Association, (NJPCA), the New Jersey Department of Health, and LabCorp hosted a press conference to highlight Sexually Transmitted Infection (STI) Awareness Montht the press