HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

Equinix NEWS

Neurocrine Biosciences Com Stk (NBIX) Valuation Rose While Sivik Global Healthcare Raised by $385000 Its Position ...  -  Key Gazette
Green Street Investors Llc increased its stake in Equinix Inc (EQIX) by 82.17% based on its latest 2017Q4 regulatory filing with the SEC. Green Street Investors Llc bought 12,900 shares as the company's stock declined 8.22% with the market. The ...
Federated Investors Has Trimmed Tjx Cos New (TJX) Stake By $427424; Alps Advisors Decreased Equinix (EQIX ...  -  MTA Star
Alps Advisors Inc decreased Equinix Inc (EQIX) stake by 13.77% reported in 2017Q4 SEC filing. Alps Advisors Inc sold 849 shares as Equinix Inc (EQIX)'s stock declined 8.22%. The Alps Advisors Inc holds 5,318 shares with $2.41M value, down from 6,167 ...
Equinix Inc (EQIX) and Visteon Corp (VC) Seeing Needle Moving This Session  -  The Caller
Shares of Equinix Inc (EQIX) are moving on volatility today 0.16% or $0.67 from the open. The NASDAQ listed company saw a recent bid of $410.20 and 261200 shares have traded hands in the session. When dealing with the equity markets, investors are ...

Analysts Expect Equinix (EQIX) Will Post Earnings of $4.94 Per Share  -  StockNewsTimes
Brokerages predict that Equinix (NASDAQ:EQIX) will report $4.94 earnings per share for the current fiscal quarter, according to Zacks. Seven analysts have made estimates for Equinix's earnings. The highest EPS estimate is $5.07 and the lowest is $4.79 ...
Moore Capital Management LP Position in Equinix INC (EQIX) Boosted by $56.63 Million  -  Press Telegraph
Mu Investments Ltd stated it has 0.02% of its portfolio in Equinix, Inc. (NASDAQ:REIT). Adelante Lc has 195,130 shares for 4.8% of their portfolio. Macquarie Gru Limited accumulated 268,685 shares. Comerica Bancorporation has 36,294 shares. Barton ...
Moore Capital Management LP Holds Holding in Equinix INC (EQIX)  -  Gоldmаn Blоg (blog)
It dived, as 33 investors sold EQIX shares while 156 reduced holdings. 66 funds opened positions while 185 raised stakes. 74.06 million shares or 1.05% more from 73.29 million shares in 2017Q3 were reported. Nuwave Investment Management Limited Com ...
As Equinix INC (EQIX) Share Value Declined, Moore Capital Management LP Boosted Stake by $56.63 Million  -  Finance News Daily
Covington Capital Mngmt has invested 0% in Equinix, Inc. (NASDAQ:REIT). Stephens Inc Ar has invested 0.27% in Equinix, Inc. (NASDAQ:REIT). Atlantic Tru Gru Ltd owns 130,733 shares. Alkeon Cap Lc stated it has 516,765 shares. Alliancebernstein Lp has ...
Equinix INC (EQIX) Stake Maintained by Moore Capital Management Lp  -  NMSU Herald
1832 Asset Limited Partnership holds 0.02% in Equinix, Inc. (NASDAQ:REIT) or 14,300 shares. Allen Investment Management Ltd Liability Corporation, New York-based fund reported 131,586 shares. 90,961 were accumulated by Hsbc Public Limited Liability ...
Equinix INC (EQIX) Shareholder Moore Capital Management LP Boosted Its Holding by $56.63 Million as Stock Value ...  -  The Malibu Report
Glg Limited Co reported 3,373 shares stake. Virtu Financial Limited Liability holds 0.04% or 1,502 shares. Highbridge Limited Liability Company reported 10,342 shares. Conning Inc holds 1,470 shares. 2,420 are held by Riverhead Capital Limited Co. D E ...
As Equinix INC (EQIX) Stock Price Declined, Holder Moore Capital Management LP Has Boosted Holding  -  Reurope
Northwestern Mutual Wealth Mngmt reported 0% in Equinix, Inc. (NASDAQ:REIT). Quantitative Systematic Strategies Limited Liability Company invested in 0.15% or 1,282 shares. Highbridge Mngmt Ltd Liability Corporation accumulated 10,342 shares. The ...
 

Equinix Videos

equinixvideos
16:52:56
equinixvideos
Join the ranks at Equinix
12:28:39
Join the ranks at Equinix
Equinix 101
17:34:49
Equinix 101
An Introduction to Equinix Infrastructure Services
23:44:06
An Introduction to Equinix Infrastructure Services
Equinix & Fortanix: Why is Equinix SmartKey uniquely positioned to help solve for data sovereignty?
17:34:55
Equinix & Fortanix: Why is Equinix SmartKey uniquely positioned to help solve for data sovereignty?
Equinix Brasil
20:39:00
Equinix Brasil
Tour Virtual – IBX® SP3 Equinix
19:30:52
Tour Virtual – IBX® SP3 Equinix
The Magic of Equinix -  bringing cultures, nationalities, languages & backgrounds together!
21:36:58
The Magic of Equinix - bringing cultures, nationalities, languages & backgrounds together!
Data center tour: Equinix
19:35:22
Data center tour: Equinix
Equinix IBX® Sao Paulo 3 (SP3) Data Center Tour
20:59:25
Equinix IBX® Sao Paulo 3 (SP3) Data Center Tour
 

Equinix Images

GoGrid joins Equinix Cloud Exchange - insideBIGDATA
GoGrid joins Equinix Cloud Exchange - insideBIGDATA
8 Predictions for IT in 2018 | InterConnections - The ...
8 Predictions for IT in 2018 | InterConnections - The ...
11 Beautiful Photos of the new Equinix MI3 IBX Data Center ...
11 Beautiful Photos of the new Equinix MI3 IBX Data Center ...
Equinix Big Data Platform and Cassandra - A view into the ...
Equinix Big Data Platform and Cassandra - A view into the ...
IT Agility through Collaborative Ecosystems ...
IT Agility through Collaborative Ecosystems ...
15 Fintech Startups To Watch In 2015
15 Fintech Startups To Watch In 2015
When Is a Connected Car Not a Car? | InterConnections ...
When Is a Connected Car Not a Car? | InterConnections ...
Corporate black geometric polygonal motion background ...
Corporate black geometric polygonal motion background ...
Reykjavik Winter Wallpaper
Reykjavik Winter Wallpaper
Anatomy of the JaguarPC Data Center | JaguarPC Blog
Anatomy of the JaguarPC Data Center | JaguarPC Blog
 

Equinix WebSites

 

Equinix Wiki

Equinix, Inc. is an American multinational company headquartered in Redwood City, California, that specializes in internet connection and related services. It is the leading global colocation data center provider by market share, and it operates 175+ data centers in 44 major metropolitan areas in 22 countries on five continents.The company offers colocation, interconnection solutions and related services to enterprises, content companies, systems integrators and 1,500+ network service providers worldwide. Its data centers host 2,750+ cloud and IT service providers. It offers several interconnection services, including Equinix Cross Connects, Equinix Performance Hub and Equinix Data Hub. The company operates the Equinix Cloud Exchange Fabric and an Internet Exchange. Its Professional Services group offers various consulting and technical support services.It listed on the NASDAQ stock exchange under the ticker symbol EQIX and as of 2017, it had around 6,200 employees globally.Equinix reported 2016 revenues of $3.61 billion.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861