HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites
 

El Paso Corp NEWS

Carrell joins Southwestern Energy as COO  -  Oil & Gas Journal
A new US administration overhauled its predecessor's approach to energy regulation in 2017—mostly for the better, say oil and gas industry representatives. As Oil & Gas Journal's US Political Outlook reported in the Feb. 5 issue, however, some issues ...

5 things to know in Texas energy this week  -  Houston Business Journal
Two major Texas-based energy companies, Phillips 66 and Kinder Morgan, revealed how much they each plan to spend on growth in 2018. Meanwhile, Dover Corp. plans to spin off its upstream business as a standalone, publicly-traded company based in The ...

Southwestern Energy names new COO  -  Houston Business Journal
He previously had served as executive vice president and COO of Houston-based EP Energy Corp. (NYSE: EPE) — previously part of El Paso Corp. — since 2012. He joined El Paso in 2007 and held various executive roles before helping to establish EP ...

Reed Smith Reels in Norton Rose Fulbright Energy Veteran  -  Law.com
“I have a lot of friends there, great memories and it's a great firm,” she said of Norton Rose Fulbright, whose legacy firm Fulbright & Jaworski she joined in 2003 after serving as general counsel for natural gas giant El Paso Corp. Heeg said she knows ...

Former El Paso CEO's new energy co. acquires local companies, eyes more deals  -  Houston Business Journal
He joined El Paso in 2013 from Houston-based Halliburton Co. and has more than 30 years of experience in the energy industry, per the release. Tally CEO Chris Dorros' experience includes senior vice president roles at Houston-based Forum Energy ...

Working Effectively With Tribes On Energy Projects  -  northamericanshalemagazine.com
An example of the energy industry's effective support of tribal consultation is the Ruby Pipeline Project—a 700-mile interstate pipeline that delivers natural gas produced in the Rockies Basin to the West Coast. As with DAPL, Ruby does not cross any ...

Jana Takes Stake In EQT Energy To Kill Rice Deal  -  Benzinga
Having previously disrupted the energy sector with a breakup of El Paso Corporation Preferred Stock (NYSE: EP-C) operations, Jana Partners LLC is taking a swing at natural gas. The activist hedge fund's latest 13F revealed a stake in Resolute Energy ...
Marathon Oil Appoints Dane Whitehead Executive Vice President and Chief Financial Officer  -  GlobeNewswire (press release)
Houston, Feb. 23, 2017 (GLOBE NEWSWIRE) -- Marathon Oil Corporation (NYSE: MRO) announced today that Dane Whitehead has been appointed executive vice president and chief financial officer, with an anticipated effective date of March 6. Whitehead, 55 ...
Del. Supreme Court Overturns Chancery's $142M Award  -  Law360
Vice Chancellor Laster found $171 million worth of damages overall for the part of the deal for which he considered El Paso liable. That led to a $100.2 million award decision in early February based on the share of claims attributable to limited ...
Kinder Morgan wins dismissal of $171 mln investor lawsuit  -  Reuters
Jeffrey Squire, an attorney who represented the plaintiff, declined to comment. A Kinder Morgan spokesman was not immediately available for comment. The dismissed lawsuit began with deals in 2011 in which El Paso Pipeline Partners, an MLP, bought ...
 

El Paso Corp Videos

Company Profile: El Paso Corporation (NYSE:EP)
13:33:17
Company Profile: El Paso Corporation (NYSE:EP)
El Paso Corp facilities
21:12:10
El Paso Corp facilities
Oil gas bid RIL eyes EL Paso Corp unit
09:21:27
Oil gas bid RIL eyes EL Paso Corp unit
El Paso Corporation \
20:57:34
El Paso Corporation \"Right\" Scenario
Pre El Paso de la Muerte (Alan Corp - Tabachos.com)
04:27:11
Pre El Paso de la Muerte (Alan Corp - Tabachos.com)
DownTown El Paso Haul !!! :)
20:17:38
DownTown El Paso Haul !!! :)
Doug Foshee, CEO, Chairman & President, El Paso Corporation - Genesys Works
03:48:03
Doug Foshee, CEO, Chairman & President, El Paso Corporation - Genesys Works
El Paso Corp. Building Renovation | Gilbane Building Company
14:56:48
El Paso Corp. Building Renovation | Gilbane Building Company
mamadas en job corps el paso tx
01:04:48
mamadas en job corps el paso tx
El Paso Pipeline Acquires Remaining 14% Interest In Colorado Interstate Gas (EP)
19:47:43
El Paso Pipeline Acquires Remaining 14% Interest In Colorado Interstate Gas (EP)
 

El Paso Corp Images

Louisiana oil refineries admit to accidental air pollution ...
Louisiana oil refineries admit to accidental air pollution ...
AWON Willie & Joe Page
AWON Willie & Joe Page
Ruidoso Map Related Keywords & Suggestions - Ruidoso Map ...
Ruidoso Map Related Keywords & Suggestions - Ruidoso Map ...
Cardinal Health: Healthcare Solutions, Logistics & Supplies
Cardinal Health: Healthcare Solutions, Logistics & Supplies
Cotton Valley Tight Gas News, Wells, Formation, Markets ...
Cotton Valley Tight Gas News, Wells, Formation, Markets ...
30 Curiosidades de Dragon Ball Z Entra ! - Taringa!
30 Curiosidades de Dragon Ball Z Entra ! - Taringa!
Amtrak Sunset Limited
Amtrak Sunset Limited
APARATO RESPIRATORIO on emaze
APARATO RESPIRATORIO on emaze
Rihanna provoca dos arrestos con una foto - Taringa!
Rihanna provoca dos arrestos con una foto - Taringa!
Huesos Del Craneo
Huesos Del Craneo
 

El Paso Corp WebSites

El Paso Corporation was a provider of natural gas and related energy products and was one of North America's largest natural gas producers until its acquisition by Kinder Morgan in 2012.
El Paso (/ ɛ l ˈ p æ s oʊ /; from Spanish, "the pass") is a city in and the seat of El Paso County, Texas, United States.It is situated in the far western corner of the U.S. state of Texas.
According to our research of Texas and other state lists there were 1,163 registered sex offenders living in El Paso, Texas as of April 17, 2018. The ratio of number of residents in El Paso to the number of sex offenders is 587 to 1. The number of registered sex offenders compared to the number of ...
At EP Energy, we have a passion for finding and producing the oil and natural gas that enriches people's lives.
El Paso Security Services by Recon Services Corp.,
Degree Plans UTEP The University of Texas at El Paso
Search Used Cars in El Paso at Rainbow Motors to find the best cars El Paso, El Paso, TX, Las Cruces, NM deals from Rainbow Motors.
Search El Paso, TX real estate for sale. View property details of the 5,061 homes for sale in El Paso at a median listing price of $159,000.
Find detailed information about employment opportunities and benefits. UMC, in El Paso, Texas, is a dynamic and unique place to work. Apply for your next job today.
The First Tee of Greater El Paso is a Youth development program where life skills, core values and healthy habits are taught through the game of golf. The Programs home is Ascarate Golf Course
McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Micronesia Radio New Zealand The leaders of the nine states, territories and countries of Micronesia are gathering this week to thrash out issues including climate change, migration and their close but complicated relationship with the United States; The non government agency

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

LabCorp Jersey Shore Online NEW JERSEY – Ocean Health Initiatives, (OHI), the New Jersey Primary Care Association, (NJPCA), the New Jersey Department of Health, and LabCorp hosted a press conference to highlight Sexually Transmitted Infection (STI) Awareness Montht the press