HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites
 

Cognizant Technology Solutions NEWS


$3.90 Billion in Sales Expected for Cognizant Technology Solutions Corp (CTSH) This Quarter  -  registrarjournal.com
Brokerages forecast that Cognizant Technology Solutions Corp (NASDAQ:CTSH) will report $3.90 billion in sales for the current fiscal quarter, Zacks reports. Ten analysts have provided estimates for Cognizant Technology Solutions' earnings, with the ...
Cognizant Technology Solutions Corporation - CTSH - Stock Price Today - Zacks Zacks
Cognizant Technology Solutions Corporation (NasdaqGS:CTSH) Quant Update and Deep Dive into Returns  -  The Herald
In trying to determine how profitable a company is per asset dollar, we can take a look at the firm's Return on Assets. Return on assets is calculated by dividing a company's net income (usually annual income) by its total assets, and is displayed as a ...
Cognizant Technology Solutions Corp (CTSH) COO Sells 2500 Shares of Stock  -  Newburgh Gazette
Veeraraghavachary Srinivasan had sold 2,500 shares worth $205,725. Cognizant Technology Solutions Corp has a 52-week low of $45.44 and a 52-week high of $67.13. Another trade for 1,926 shares valued at $99,559 was made by Kuipers Peter J. on Friday ...

Cognizant Technology Solutions (CTSH) Earning Somewhat Favorable Press Coverage, Analysis Finds  -  The Ledger Gazette
Press coverage about Cognizant Technology Solutions (NASDAQ:CTSH) has been trending somewhat positive on Monday, according to Accern Sentiment Analysis. The research group scores the sentiment of press coverage by analyzing more than 20 million news ...
Cognizant Technology Solutions Corporation (NasdaqGS:CTSH) Boasts a QI Value of Cognizant Technology Solutions ...  -  Danvers Record
The Current Ratio of Cognizant Technology Solutions Corporation (NasdaqGS:CTSH) is 3.21. The Current Ratio is used by investors to determine whether a company can pay short term and long term debts. The current ratio looks at all the liquid and non ...

Cognizant Technology Solutions (CTSH) Receives New Coverage from Analysts at Sanford C. Bernstein  -  registrarjournal.com
Sanford C. Bernstein began coverage on shares of Cognizant Technology Solutions (NASDAQ:CTSH) in a research report released on Wednesday, March 28th, MarketBeat.com reports. The firm issued a market perform rating and a $57.50 target price on the ...
Is Cognizant Technology Solutions Corporation (NasdaqGS:CTSH) Undervalued? MF Rank of 2957 in Focus  -  Alba Journal
Cognizant Technology Solutions Corporation (NasdaqGS:CTSH) has a current MF Rank of 2957. Developed by hedge fund manager Joel Greenblatt, the intention of the formula is to spot high quality companies that are trading at an attractive price. The ...
Martin Currie LTD Cut By $1.67 Million Its Cognizant Technology Solutio (CTSH) Holding; Clifford Swan Investment ...  -  UtahHerald.com
Among 33 analysts covering Cognizant Technology Solutions Corp. (NASDAQ:CTSH), 26 have Buy rating, 1 Sell and 6 Hold. Therefore 79% are positive. Cognizant Technology Solutions Corp. had 90 analyst reports since August 6, 2015 according to ...

Digital Asset Management (DAM) Software Market 2023 Overview by Key Finding, Scope, Top Impacting Factors ...  -  Business Services
Top Companies Profiled in this Report includes, ADAM Software NV (Belgium), Adobe Systems Incorporated (USA), Canto, Inc. (USA), CELUM GmbH (Austria), Cognizant Technology Solutions Corporation (USA), EMC Corporation (USA), Extensis (USA), Hewlett ...

Salil Parekh sets 3-year target to stabilize, turn around Infosys  -  Livemint
In recent years, Infosys has ceded the bellwether tag to rivals such as Tata Consultancy Services Ltd and US-based Cognizant Technology Solutions, which have consistently outpaced the Bengaluru-based firm in terms of new business generated per year ...
 

Cognizant Technology Solutions Videos

Cognizant Technology Solutions - Sucide letter-Harassment & Demotivating-Intolerance
14:50:43
Cognizant Technology Solutions - Sucide letter-Harassment & Demotivating-Intolerance
Where can Cognizant take YOU? — Cognizant Careers — Cognizant
04:20:08
Where can Cognizant take YOU? — Cognizant Careers — Cognizant
Cognizant
07:08:58
Cognizant
Cognizant Technology Solutions Interview Tips and Questions
17:26:48
Cognizant Technology Solutions Interview Tips and Questions
Cognizant  Campus Recruitment Procedure Academic Criteria
18:52:15
Cognizant Campus Recruitment Procedure Academic Criteria
Company Profile: Cognizant Technology Solutions (NYSE: CTS)
20:37:40
Company Profile: Cognizant Technology Solutions (NYSE: CTS)
Cognizant– Recruitment Notification 2017, IT Jobs, Walkin, Career, Oppurtunities, Campus placements
07:40:56
Cognizant– Recruitment Notification 2017, IT Jobs, Walkin, Career, Oppurtunities, Campus placements
Employees Up Against Layoffs By IT Major, Cognizant In Chennai
12:22:19
Employees Up Against Layoffs By IT Major, Cognizant In Chennai
How To Crack Cognizant Technology Solutions/CTS
07:30:13
How To Crack Cognizant Technology Solutions/CTS
Cognizant Dance at Shollinganallur location
20:08:34
Cognizant Dance at Shollinganallur location
 

Cognizant Technology Solutions Images

Cognizant Technology Solutions on the Forbes America's ...
Cognizant Technology Solutions on the Forbes America's ...
FIT-Jobbörse
FIT-Jobbörse
CTS Webmail URL - TCS Webmail Login
CTS Webmail URL - TCS Webmail Login
File:Cognizant Technology Solution's office in Teaneck ...
File:Cognizant Technology Solution's office in Teaneck ...
Cognizant, Kolkata | Photo by Apai and Guddi One of the ...
Cognizant, Kolkata | Photo by Apai and Guddi One of the ...
File:Cognizant-Pune.jpg - Wikipedia
File:Cognizant-Pune.jpg - Wikipedia
Srinathji Glazing Pvt. Ltd. - Project Gallery
Srinathji Glazing Pvt. Ltd. - Project Gallery
ATAGTR2017 Artificial Intelligence in Software Testing ...
ATAGTR2017 Artificial Intelligence in Software Testing ...
R reproducibility
R reproducibility
Top 5 Indian IT service providers grew 13.3% in 2012 ...
Top 5 Indian IT service providers grew 13.3% in 2012 ...
 

Cognizant Technology Solutions WebSites

Cognizant (Nasdaq-100: CTSH) is a world-leading professional services company, transforming business, operating and IT models for the digital era.
Cognizant is an American multinational corporation that provides IT services, including digital, technology, consulting, and operations services. It is headquartered in Teaneck, New Jersey, United States.
Born global, Cognizant offers a unique learning and work environment. Search for jobs worldwide and see our newest training partnership with Per Scholas.
Cognizant Technology Solutions #263 on the Forbes America's Best Employers List
Thinking about adding Cognizant Technology Solutions (NASDAQ:CTSH) stock to your your portfolio? View CTSH's stock price, price target, analyst ratings, dividend information, earnings history, financials, history, insider trades, news headlines and SEC filings in real-time at MarketBeat.
LONDON, UK / ACCESSWIRE / February 20, 2018 / Active-Investors has a free review on Cognizant Technology Solutions Corp. (NASDAQ: CTSH) ("Cognizant") following the Company's announcement that ...
Cognizant Technology Solutions Corp. stock price, stock quotes and financial overviews from MarketWatch.
Check out Cognizant's latest company news stories, events and updated company press releases.
View the basic CTSH stock chart on Yahoo Finance. Change the date range, chart type and compare Cognizant Technology Solutions against other companies.
View Cognizant Technology Solutions Corporation CTSH investment & stock information. Get the latest Cognizant Technology Solutions Corporation CTSH detailed stock quotes, stock data, Real-Time ECN, charts, stats and more.
McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861