HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites wiki
 

Chugach Alaska Corporation NEWS


Humboldt Forum And Selective Amnesia: Research Instead Of Restitution Of African Artefacts.  -  Modern Ghana (press release) (blog)
In November 2015, a delegation from the Chugach Alaska Corporation visited the Ethnologisches Museum with the aim of initiating cooperation on future projects. One of the reasons for this was their interest in creating a virtual presentation of all the ...

German museum returning objects robbed from Alaskan graves  -  KTUU.com
BERLIN (AP) - A German museum is returning nine objects from its collection that it says were taken without consent from the graves of native people in Alaska. The Prussian Cultural heritage Foundation said Monday the objects will be returned from ...

Chugach Alaska Corp. supports Shepard Point Facility  -  Cordova Times
Editor's Note: This letter by Sheri Buretta, chairman of the board for the Chugach Alaska Corporation, was written on Sept. 29 to Native Village of Eyak Traditional Council in support of the Shepard Point oil response facility. Chugach Alaska ...

New ventures aim to safeguard traditional lands  -  Cordova Times
Editor's note: This article was written by the communications staff of Chugach Alaska Corp. for The Cordova Times. Chugach Alaska Corporation's (Chugach) history in Alaska extends back more than 5,000 years. For more than five centuries, our ancestors ...

BLM Alaska Patents 340000 acres to State of Alaska and Alaska Native Corporations  -  youralaskalink
Along with these patents, there were two additional conveyances of a historical site for Chugach Alaska Corporation and a 160-acre Native allotment near Copper Center. For more than 40-years, the BLM has been involved with the survey and conveyance of ...

Seeing the value of the forest in the trees: Chugach enters California's carbon market  -  Alaska Public Radio Network
Instead of harvesting their forests for timber, the Chugach Alaska Corporation is selling an innovative new forest product: the carbon stored in the trees. Listen now. “Anyone who's been to Prince William Sound can tell you it's an area of tremendous ...
Ravinia Capital Advises on Sale of Rex Electric and Technologies, LLC to Chugach Alaska Corporation  -  PR Web (press release)
Ravinia Capital LLC is pleased to announce the sale of Rex Electric and Technologies, LLC (Rex), a Chicago-based electrical and technology contractor, to Chugach Alaska Corporation (Chugach). Ravinia Capital was sell-side advisor to Rex on the ...

Chugach Alaska Corp. buys Chicago electrical company  -  Alaska Dispatch News
Chugach Alaska Corporation purchased Rex Electric and Technologies, a Chicago-based provider of electrical and technology services for general contractors and building owners, the Alaska Native corporation announced Tuesday. "The addition of Rex to the ...

YWCA Alaska/BP Announce Women of Achievement Awardees  -  youralaskalink
This is the 27th annual YWCA Alaska/BP women of Achievement & Youth Awards. The YWCA stated in a press release, “it now represents an Academy of 321 women who have shaped our last 27 years and will continue to shape the next 27 years as we work to ...

US Capitol Christmas tree is the first to come from Alaska; Companion Trees From Tongass  -  SitNews
The lead non-profit partner, Choose Outdoors, solicited sponsors to help reduce costs of shipping the 2015 U.S. National Christmas tree from Alaska. These sponsors included; Shell, Skybitz, Alaska Airlines, Alaska Crane, Alaska Railroad, Granite ...
 

Chugach Alaska Corporation Videos

Chugach Alaska Corporation
21:26:11
Chugach Alaska Corporation
Chugach Employee Video
01:09:06
Chugach Employee Video
Chugach Region Video
22:56:11
Chugach Region Video
Russian New Year 2018
18:17:50
Russian New Year 2018
Chugach Alaska Corporation Acquires Rex Electric and Technologies
17:31:20
Chugach Alaska Corporation Acquires Rex Electric and Technologies
Chugach's Core Behaviors
18:47:57
Chugach's Core Behaviors
Chugach Alaska Corporation - Growing Native
15:28:54
Chugach Alaska Corporation - Growing Native
Nuuciq Spirit Camp
17:06:41
Nuuciq Spirit Camp
Chugach Alaska Building
09:14:40
Chugach Alaska Building
8(a): It's Working - 1
22:38:52
8(a): It's Working - 1
 

Chugach Alaska Corporation Images

Seeing the value of the forest in the trees: Chugach ...
Seeing the value of the forest in the trees: Chugach ...
Chugach Alaska Corporation Team Receives Award For Most ...
Chugach Alaska Corporation Team Receives Award For Most ...
Tatitlek Shareholder Services
Tatitlek Shareholder Services
Scott Heisler | Professional Profile
Scott Heisler | Professional Profile
Resources, Minerals Development, Division of Economic ...
Resources, Minerals Development, Division of Economic ...
Day 15 – Christmas Eve, December 24, 2012 | Kristine's ...
Day 15 – Christmas Eve, December 24, 2012 | Kristine's ...
Panoramio - Photo of Alaska Railroad's "Glacier Discovery ...
Panoramio - Photo of Alaska Railroad's "Glacier Discovery ...
Anchorage Midtown Dental Center - Anchorage, Alaska
Anchorage Midtown Dental Center - Anchorage, Alaska
Chenega Bay - Alaska Energy Wiki
Chenega Bay - Alaska Energy Wiki
Alaska Video Production At Its Best | Channel Films
Alaska Video Production At Its Best | Channel Films
 

Chugach Alaska Corporation WebSites

 

Chugach Alaska Corporation Wiki

Chugach Alaska Corporation, or CAC, is one of thirteen Alaska Native Regional Corporations created under the Alaska Native Claims Settlement Act of 1971 (ANCSA) in settlement of aboriginal land claims. Chugach Alaska Corporation was incorporated in Alaska on June 23, 1972. Headquartered in Anchorage, Alaska, Chugach Alaska Corporation is a for-profit corporation with over 2,200 Alaska Native shareholders primarily of Chugach Alutiiq, Eyak, and Tlingit descent.

McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861