HOME | COUNTRIES | CITIES | COMPANIES | SPORTS | CARS
news videos images websites
 

BJs Wholesale Club NEWS


Dunkin' Donuts US Names Stephanie Meltzer-Paul Vice President, Digital and Loyalty Marketing  -  RestaurantNews.com (press release)
Ms. Meltzer-Paul joins Dunkin' Donuts after most recently serving as Vice President, Member Engagement and Loyalty at BJ's Wholesale Club. In this role, she led a team responsible for developing and spearheading the marketing strategy for the My BJ's ...

Dunkin' Donuts taps former BJ's exec for marketing role  -  Chain Store Age
The company announced the appointment of Stephanie Meltzer-Paul as VP, digital and loyalty marketing. She joins Dunkin' Donuts after most recently serving as VP, member engagement and loyalty at BJ's Wholesale Club. Previously, Meltzer-Paul was senior ...

Dunkin' taps new digital leader  -  Food Business News
CANTON, MASS. — Stephanie Meltzer-Paul has been named vice-president of digital and loyalty marketing at Dunkin' Donuts U.S. and will join the company in early May. In her new role, Ms. Meltzer-Paul will lead the further development of the brand's DD ...

Instacart shopping service now available to North Fork customers  -  Suffolk Times
A retail delivery service that uses personal shoppers to hand-pick groceries and other items is now available to some North Fork residents. As of Thursday, Instacart expanded its reach eastward, making personal grocery shopping available to local ...
WSJ: BJ's Wholesale Club owners prepare initial public offering  -  Seeking Alpha
Firms that own BJ's Wholesale Club are readying an initial public offering in the coming months, The Wall Street Journal reports. The company's filed confidential registration and could start trading as soon as May, according to the report. It's owned ...

BJ's Wholesale Club Set For IPO  -  Wall Street Journal
Leonard Green and CVC took BJ's private in 2011 in a nearly $3 billion deal and have since paid themselves a number of dividends. Founded in 1984, BJ's has more than 210 membership-based warehouse clubs in 15 states in the Eastern U.S., offering ...

Same-day grocery delivery services comes to Stroudsburg  -  PA home page
STROUDSBURG, MONROE COUNTY (WBRE/WYOU) - Shopping for groceries and everyday essentials just got easier for people who live in Stroudsburg. "Instacart," a retail delivery service, announced Wednesday that it is expanding to the Stroudsburg area to ...
BJ's Charitable Foundation Donates a Year's Supply of Gas and Tires to the Maryland Food Bank  -  The Auto Channel (press release)
WESTBOROUGH, Mass., April 19, 2018 -- BJ's Wholesale Club today announced that the BJ's Charitable Foundation has donated a one-year supply of gas and tires (valued at $5,000) to the Maryland Food Bank to celebrate the new BJ's Gas® location in ...

Instacart delivery expands to Reading, Stroudsburg, Quakertown  -  Lehigh Valley Business
“We have been very successful in expanding,” said George Shotz, regional operations manager. Billed as an Uber-like service, customers can order groceries online and then have an Instacart contractor shop and deliver the items. In the Stroudsburg/East ...
Virtual grocery shopping arrives in Massena, surrounding areas  -  WatertownDailyTimes.com
MASSENA — Virtual grocery shopping has arrived in the area. Starting today, some area residents who need items from Price Chopper or BJ's Wholesale Club can have them delivered to the comfort of their home for a fee, courtesy of Instacart, a retail ...
 

BJs Wholesale Club Videos

BJ'S WHOLESALE CLUB SHOP WITH ME 2018
06:24:09
BJ'S WHOLESALE CLUB SHOP WITH ME 2018
BJ's Wholesale Club
19:58:01
BJ's Wholesale Club
Take a tour of BJ's Wholesale Club
17:10:11
Take a tour of BJ's Wholesale Club
COUPONING AT BJ'S: HOW TO SAVE MONEY AT BJ'S WHOLESALE CLUB!
21:19:04
COUPONING AT BJ'S: HOW TO SAVE MONEY AT BJ'S WHOLESALE CLUB!
Food Shopping at BJs Wholesale Club
01:24:56
Food Shopping at BJs Wholesale Club
Food Shopping at BJs Wholesale Club | 2017
02:05:57
Food Shopping at BJs Wholesale Club | 2017
Shopping At Bj's Wholesale Club!
13:00:04
Shopping At Bj's Wholesale Club!
How to use Express Scan at BJ's Wholesale Club
19:11:59
How to use Express Scan at BJ's Wholesale Club
BJs Wholesale Club
19:02:42
BJs Wholesale Club
BJs Wholesale Club
06:35:44
BJs Wholesale Club
 

BJs Wholesale Club Images

Berkley Jensen Nantucket 6-Piece Wicker Patio Set - BJs ...
Berkley Jensen Nantucket 6-Piece Wicker Patio Set - BJs ...
Stock up on last-minute necessities at BJ's Wholesale Club
Stock up on last-minute necessities at BJ's Wholesale Club
Commer Client details
Commer Client details
Case Study: Costco Wholesale in 2008: Mission, Business ...
Case Study: Costco Wholesale in 2008: Mission, Business ...
Scutti Enterprises
Scutti Enterprises
L.A. Fitness Sports Club - EW Howell
L.A. Fitness Sports Club - EW Howell
Save $6 on Swiffer WetJet Starter Kit at BJ's
Save $6 on Swiffer WetJet Starter Kit at BJ's
Meijer Store | www.imgkid.com - The Image Kid Has It!
Meijer Store | www.imgkid.com - The Image Kid Has It!
Fiji Water, 24 pk./16.9 oz. - BJ's Wholesale Club
Fiji Water, 24 pk./16.9 oz. - BJ's Wholesale Club
Skywalker Trampolines 15' Square Trampoline with Enclosure ...
Skywalker Trampolines 15' Square Trampoline with Enclosure ...
 

BJs Wholesale Club WebSites

© 1997-2018 BJ's Wholesale Club, Inc. Privacy Policy; Careers; Company Background; Community Relations; Item Added Successfully Error Adding to Wishlist
Here’s every hour we’re open this holiday season, so you can knock off those wish lists, grocery lists and party plans. Please note Clubs listed below have different holiday hours due to local ordinances.
Order online and get groceries from Bjs delivered in two hours or less
Save $0.50. COTTONELLE® on any ONE (1) COTTONELLE® Toilet Paper (6-pack or larger) Exp: 04/21/18
11 reviews of BJ's Wholesale Club "Good for provisions. I go with a list; in and out. Not nice like Wallingford, but functional. If a Costco was in my area, I would prefer it.
McIntosh Laboratory Technical Journal Burmester Audiosysteme, Bowers & Wilkins, Pioneer, HARMAN, Boston Acoustics, Clarion, Meridian Audio, Bang & Olufsen, Blaupunkt, McIntosh Laboratory , Alpine Electronics, Bose and Dynaudioample PDF Copy of Report at https://marketz/report/global

Sociometric Solutions Huffington Post A few years ago I wrote about an MIT spin-out called Sociometric Solutions hey had taken a leaf out of the Moneyball playbook and developed ID badges for employees to wear at workhe badges come with a sensor in built within it that allows managers

Sauer Danfoss HighTech Caller The Hydraulic Pumps Module Assembly Market is expected to develop at a Compounded Annual Growth Rate (CAGR) of + percent in the course of time of the forecasted period 2018-2025he report offers an extensive analysis of the Hydraulic Pumps Module

Applied Biosystems Science A SuperScript VILO cDNA Synthesis kit (Invitrogen) was used for complementary DNA (cDNA) synthesis and PROBE FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems ) for the TaqMan Master Mixrimers for murine Esr1 (5ACCCGCCGCCGCAGCTGTCTCCTT and 5

Raybestos Auto Service World Raybestos has partnered with top suppliers in the automotive industry for its 1953 Chevy Pickup Build Project to restore and upgrade the Raybestos 1953 Chevrolet pickup truckhe suppliers joining Raybestos in the project include Schwartz Performance

Advanced Micro Devices android media cell Technical Facts about Advanced Micro Devices , Inc AMD ): The Relative Strength Index value of AMD is 44he Relative Strength Index (RSI) was developed by Jelles Wildere first spoke about his system in a book called New Concepts in Technical

Arizona Beverage Company Herald of Truth 24 The report offers classification of the Fermented Beverages marketn addition to this, the report offers the analysis of trend and estimations of the market size based on of the pipeline of the Fermented Beverages markethe key companies Dohler

Micronesia The Jet Newspaper Pohnpei, Federated States of Micronesia – Discussions informing the Federated States of Micronesias National Climate Change and Disaster Risk Finance Assessment show that the country continues to demonstrate a commitment to strengthening country

LabCorp StreetInsiderm Walgreens and LabCorp ® (NYSE: LH) today announced the expansion of their LabCorp at Walgreens collaboration into Floridaen new LabCorp patient service centers will open within Walgreens stores in April and May, with four serving the Gainesville

Kennametal Yankee Analysts The Shareholder Yield is a way that investors can determine how much money shareholders are receiving from a firm through a combination of dividends, share repurchases and debt reductionhe Shareholder Yield of Kennametal IncNYSE:KMT) is 05861